View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13692_high_18 (Length: 250)
Name: NF13692_high_18
Description: NF13692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13692_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 23817238 - 23817004
Alignment:
| Q |
1 |
cccctttttacaaaatccatggtttgcaacaaacatgaattttgttgttgacatcgccacatttgttttcagctagcttctcttagtcctactatagaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
23817238 |
cccctttttacaaaatccatggtttgcaacaaacatgaattttgttgttgacatcgccacatttgttttcagctagcttctcttagtcctactatag-ca |
23817140 |
T |
 |
| Q |
101 |
tagacaaggactagtagtagtaaataggctctatcaagataaagagattgcggctaggaatttcagctgtctgatctcaaattaacagttgagattgttt |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
23817139 |
tagacaaggactagtagta---aataggctctatcaagataaagagattgcggctaggtatttcagctgtctgatctcaaattaaccgttgagattgttt |
23817043 |
T |
 |
| Q |
201 |
aaaaagaattgaccgacggtgtaatctaaaccttttcat |
239 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
23817042 |
aaaaataattgactgacggtgtaatctaaaccttttcat |
23817004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 167 - 200
Target Start/End: Original strand, 33554275 - 33554308
Alignment:
| Q |
167 |
ctgtctgatctcaaattaacagttgagattgttt |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
33554275 |
ctgtccgatctcaaattaacagttgagattgttt |
33554308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University