View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13692_low_17 (Length: 280)

Name: NF13692_low_17
Description: NF13692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13692_low_17
NF13692_low_17
[»] chr1 (3 HSPs)
chr1 (180-276)||(1132351-1132447)
chr1 (16-96)||(1132188-1132268)
chr1 (117-149)||(1132288-1132320)


Alignment Details
Target: chr1 (Bit Score: 97; Significance: 1e-47; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 180 - 276
Target Start/End: Original strand, 1132351 - 1132447
Alignment:
180 acatagagtattaccggtggcagaaatggatgattgagactcaatagttgcagtgatggtggagttcttgggagtgaggttttgggagcaaacaaga 276  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1132351 acatagagtattaccggtggcagaaatggatgattgagactcaatagttgcagtgatggtggagttcttgggagtgaggttttgggagcaaacaaga 1132447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 16 - 96
Target Start/End: Original strand, 1132188 - 1132268
Alignment:
16 cagaaacatatttctttgtgttggtttttagtacttattgtcgttttgtctatctactcaagagaagaaccatatctcttg 96  Q
    |||||||||||||||||||||||||||  ||||||||||||||||| ||||||||||||||||||||||||||||||||||    
1132188 cagaaacatatttctttgtgttggtttccagtacttattgtcgtttcgtctatctactcaagagaagaaccatatctcttg 1132268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 117 - 149
Target Start/End: Original strand, 1132288 - 1132320
Alignment:
117 gttcattcaatttttgctagcataatttatact 149  Q
    |||||||||||||||||||||||||||||||||    
1132288 gttcattcaatttttgctagcataatttatact 1132320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University