View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13693_low_14 (Length: 201)
Name: NF13693_low_14
Description: NF13693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13693_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 86 - 181
Target Start/End: Original strand, 18245101 - 18245196
Alignment:
| Q |
86 |
agcgatggaagtagtgatggagatcgtggaggtggcggaaacttatttttactgaccaagtgtggaggaaacgtttttgattgaagtggtggagat |
181 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18245101 |
agcgatggaggtagtgatggagatcgtggaggtggcggaaacttctttttactgaccaagtgtggaggaaacgtttttgattgaagtggtggagat |
18245196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University