View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13693_low_14 (Length: 201)

Name: NF13693_low_14
Description: NF13693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13693_low_14
NF13693_low_14
[»] chr1 (1 HSPs)
chr1 (86-181)||(18245101-18245196)


Alignment Details
Target: chr1 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 86 - 181
Target Start/End: Original strand, 18245101 - 18245196
Alignment:
86 agcgatggaagtagtgatggagatcgtggaggtggcggaaacttatttttactgaccaagtgtggaggaaacgtttttgattgaagtggtggagat 181  Q
    ||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
18245101 agcgatggaggtagtgatggagatcgtggaggtggcggaaacttctttttactgaccaagtgtggaggaaacgtttttgattgaagtggtggagat 18245196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University