View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13693_low_8 (Length: 255)
Name: NF13693_low_8
Description: NF13693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13693_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 32882030 - 32881790
Alignment:
| Q |
1 |
tacatgaagtatatggattaattttgagatggagtgttgggagagaaaagaaaaggtaacggaagtagttagttattgtggtgagacgaactcgaaggaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32882030 |
tacatgaagtatatggattaattttgagatggagtgttgggagagaaaagaaaaggtaacggaagtagtcagttattgtggtgagacgaactcgaaggaa |
32881931 |
T |
 |
| Q |
101 |
gaaggttcaatgaaatgagatgcgattttaaataagatgaagttggttgagagaatataataactattatgattatgatgattgattgactggtcttac- |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32881930 |
gaaggttcaatgaaatgagatgcgattttaaataagatgaagttggttgagaga--ataataactattatgattatgatgattgattgactggtcttact |
32881833 |
T |
 |
| Q |
200 |
--ttttttggattgagggggatatggggttatgattgtctgtg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32881832 |
ttttttttggattgagggggatatggggttatgattgtctgtg |
32881790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University