View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13694_low_4 (Length: 245)
Name: NF13694_low_4
Description: NF13694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13694_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 86 - 222
Target Start/End: Original strand, 1907067 - 1907203
Alignment:
| Q |
86 |
agcctaaagtcaccaaaaggtagagaatccaaatccgcaatatgtgtctaataaactctatcttgtatattggatctaattaaaccctttaatattagat |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1907067 |
agcctaaagtcaccaaaaggtagagaatccaaatccgcaatatgtgtctaataaactctatcttgtatattggatctaattcaaccctttaatattagat |
1907166 |
T |
 |
| Q |
186 |
tgtaaaatgtggaatgtccaaactttataataactat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1907167 |
tgtaaaatgtggaatgtccaaactttataataactat |
1907203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University