View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13695_low_5 (Length: 378)
Name: NF13695_low_5
Description: NF13695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13695_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 346; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 346; E-Value: 0
Query Start/End: Original strand, 7 - 356
Target Start/End: Complemental strand, 23193429 - 23193080
Alignment:
| Q |
7 |
gtgagatgaacaccagtagaattgcacaaattatgaagagctggttgttgccaaacaggatggcattcaacttggttaactgctggcggaatcttagcat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23193429 |
gtgagatgaacaccagtagaattgcacaaattatgaagagctggttgttgccaaacaggatggcattcaacttggttaactgctggcggaatcttagcat |
23193330 |
T |
 |
| Q |
107 |
atccgagtaagtcttgaagcttcttagttgaaaagttgctgacaccaatcgcacgtgcttgacctgaggcgaataaaccttccattgcattccatgtctc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23193329 |
atccgagtaagtcttgaagcttcttagttgaaaagttgctgacaccaatcgcacgtgcttgacctgaggcgaataaaccttccattgcattccatgtctc |
23193230 |
T |
 |
| Q |
207 |
tgaaagacataagggaaccatgacctcagggtcccaaccccttgatcccgacttcgtcctaaacggccagtgtatctgtgacaaaataatttaccaagaa |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23193229 |
tgaaagacataagggaaccatgacctcagggtcccaaccccttgatcccgacttcgtcctaaacggccagtgtatctgtgacaaaataatttaccaagaa |
23193130 |
T |
 |
| Q |
307 |
aacatcaatttttcatacaaccatcttcagtctcagcatcaggattgaaa |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23193129 |
aacatcaatttttcatacaaccatcttcagtctctgcatcaggattgaaa |
23193080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University