View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13696_low_2 (Length: 236)
Name: NF13696_low_2
Description: NF13696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13696_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 13 - 126
Target Start/End: Original strand, 19425614 - 19425727
Alignment:
| Q |
13 |
aatatcaagagccaaactctttacacttctttttggatcagcattactttctccataccctggtctatcaaatgacacaacatatactcccaattcttca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19425614 |
aatatcaagagccaaactctttacacttctttttggatcagcatcactttctccataccctggtctatcaattgacacaacatatactcccaattcttca |
19425713 |
T |
 |
| Q |
113 |
agcaacccctaacc |
126 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
19425714 |
agcaacccctaacc |
19425727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 180 - 226
Target Start/End: Original strand, 19425778 - 19425824
Alignment:
| Q |
180 |
ttaaggtgaattaattgttaccttaggaaggtttgttgcaatcactg |
226 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
19425778 |
ttaaggtgaattaattattaccttaggtaggtttgttgcaatcactg |
19425824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University