View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13697_high_13 (Length: 257)
Name: NF13697_high_13
Description: NF13697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13697_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 256
Target Start/End: Complemental strand, 1957381 - 1957140
Alignment:
| Q |
17 |
atgatgcacaagttgttagagatcttatgagtgataaccagatacataaggatcctggttatagccggagtgagttcaagtatgatgtgcaaagcatcat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1957381 |
atgatgcacaagttgttagagatcttatgagtgataaccagatacataaggatcctggttatagccggagtgagttcaagtatgatgtgcaaagcatcat |
1957282 |
T |
 |
| Q |
117 |
gtnnnnnnnc--gacagttttttcttgcttggagatgaactcaattctacaagatctcattaatttctacaaaaggtgctgtgctctcaaaccacatcta |
214 |
Q |
| |
|
|| |||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1957281 |
gtaaaacaaactgacagttttttcgtgcttggagataaactcaattctacaagatctcattaatttctacaaaaggtgctgtgctctcaaaccacatcta |
1957182 |
T |
 |
| Q |
215 |
cggagatgatttatacggttctaaatttctatatctccttga |
256 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1957181 |
cggagagaatttatacggttctaaatttctatatctccttga |
1957140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 71
Target Start/End: Complemental strand, 1956860 - 1956806
Alignment:
| Q |
17 |
atgatgcacaagttgttagagatcttatgagtgataaccagatacataaggatcc |
71 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||| ||| | |||||||||| |
|
|
| T |
1956860 |
atgatgcacaatttgttagagatcttacgagtgataaacagttctataaggatcc |
1956806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University