View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13697_high_16 (Length: 227)

Name: NF13697_high_16
Description: NF13697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13697_high_16
NF13697_high_16
[»] chr2 (1 HSPs)
chr2 (17-220)||(27897854-27898057)


Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 17 - 220
Target Start/End: Original strand, 27897854 - 27898057
Alignment:
17 cagtgtgccccatacaagtaaaacattttgggtaatgtcggttggggtatgatgcacgtgcgggttacactttcaattgacatgcagcttcaattcacaa 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27897854 cagtgtgccccatacaagtaaaacattttgggtaatgtcggttggggtatgatgcacgtgcgggttacactttcaattgacatgcagcttcaattcacaa 27897953  T
117 ttaggtaggggaaggggagatgtacttgacttgtcaaaattatgaaaattaaatgtcaatgtaatatgtaatgcccaatgttttgcacgttagtaatata 216  Q
    ||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| ||| ||||||     
27897954 ttaggtaggggaaggggagatgtacttaacttgtcaaatttatgaaaattaaatgtcaatgtaatatgtaatgccgaatgttttgcacattattaatatt 27898053  T
217 cttc 220  Q
    ||||    
27898054 cttc 27898057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University