View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13697_low_16 (Length: 227)
Name: NF13697_low_16
Description: NF13697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13697_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 17 - 220
Target Start/End: Original strand, 27897854 - 27898057
Alignment:
| Q |
17 |
cagtgtgccccatacaagtaaaacattttgggtaatgtcggttggggtatgatgcacgtgcgggttacactttcaattgacatgcagcttcaattcacaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27897854 |
cagtgtgccccatacaagtaaaacattttgggtaatgtcggttggggtatgatgcacgtgcgggttacactttcaattgacatgcagcttcaattcacaa |
27897953 |
T |
|
| Q |
117 |
ttaggtaggggaaggggagatgtacttgacttgtcaaaattatgaaaattaaatgtcaatgtaatatgtaatgcccaatgttttgcacgttagtaatata |
216 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| ||| |||||| |
|
|
| T |
27897954 |
ttaggtaggggaaggggagatgtacttaacttgtcaaatttatgaaaattaaatgtcaatgtaatatgtaatgccgaatgttttgcacattattaatatt |
27898053 |
T |
|
| Q |
217 |
cttc |
220 |
Q |
| |
|
|||| |
|
|
| T |
27898054 |
cttc |
27898057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University