View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13698_high_20 (Length: 285)
Name: NF13698_high_20
Description: NF13698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13698_high_20 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 255; Significance: 1e-142; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 19 - 285
Target Start/End: Original strand, 43314305 - 43314571
Alignment:
| Q |
19 |
actttcttctgccaaacttgtcaaccaaaaacattgaaatgacagtagcaacaaggagagctccattggtaataaaagatgagaaaagagctgcattaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43314305 |
actttcttctgccaaacttgtcaaccaaaaacattgaaatgacagtagcaacaaggagagctccattggtaataaaagatgagaaaagagctgcattaga |
43314404 |
T |
|
| Q |
119 |
tccaaaccctaaactctggaagatgacaggtgcatagaagagaatggagttatttcctgttaactgttggaatgctggaatccctaacgcccctattatc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43314405 |
tccaaaccctaaactctggaagatgacaggtgcatagaagagaatggagttatttcctgttaactgttggaatgctggaatccctaacgcccctattatc |
43314504 |
T |
|
| Q |
219 |
agttgtggcctgtacttcctctttagaagtaccttaaatggactcttcacaggttctgctcgttcac |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |||||| |
|
|
| T |
43314505 |
agttgtggcctgtacttcctctttagaagtaccttaaatggactcttcacagcttgtgctagttcac |
43314571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 143 - 199
Target Start/End: Complemental strand, 43380408 - 43380352
Alignment:
| Q |
143 |
gacaggtgcatagaagagaatggagttatttcctgttaactgttggaatgctggaat |
199 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||| || | ||||||||||| ||||| |
|
|
| T |
43380408 |
gacaggtgcatagaagaggatggagttgtttccagtcagttgttggaatgcaggaat |
43380352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University