View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13698_high_28 (Length: 236)
Name: NF13698_high_28
Description: NF13698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13698_high_28 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 38619628 - 38619410
Alignment:
| Q |
18 |
gtaacttgtacgatcccttgaccttaacaagcttcccagaagcaacaagcttcttgatctgaaccagaagaatcttcttgaagttcgctggaagattctt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38619628 |
gtaacttgtacgatcccttgaccttaacaagcttcccagaagcaacaagcttcttgatctgaaccagaagaatcttcttgaagttcgctggaagattctt |
38619529 |
T |
|
| Q |
118 |
atgcttctcttcgatgaacttggccaaagcatactggctcgaaccgtttttctccttaagagtcacaatcgcgtccgtcaccatctgcaacaaattcaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38619528 |
atgcttctcttcgatgaacttggccaaagcatactggctcgaaccgtttttctccttaagagtcacaatcgcgtccgtcaccatctgcaacaaattcaaa |
38619429 |
T |
|
| Q |
218 |
attttcattagattacgat |
236 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
38619428 |
attttcattagatttcgat |
38619410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University