View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13698_high_30 (Length: 226)
Name: NF13698_high_30
Description: NF13698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13698_high_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 41215613 - 41215837
Alignment:
| Q |
1 |
ccatgaagcgccataattgataacagcctgcaaacaattttgaaacacgagagttaaatacatatctacgagaaatcgtatnnnnnnnnn----tgtggt |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41215613 |
ccatgaagcgccataattgataacagcctgcaaaaaattttgaaacacgagagttaaatacatatctacgagaaatcgtaaaaaaaataaaaattgtggt |
41215712 |
T |
 |
| Q |
97 |
gagaatggttgcttacgggagttttggaggatttgatgtttgtgatgatttgagtgaaattatcatcggaggaagcagatttcaagttagagtgacggtt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41215713 |
gagaatggttgcttacgggagttttggaggatttgatgtttgtgatgatttgagtgaaattatcatcggaggaagcagatttcaagttagagtgacggtt |
41215812 |
T |
 |
| Q |
197 |
gatggataaaactaagccggttcct |
221 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
41215813 |
gatggataaaactaagccggttcct |
41215837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 97 - 148
Target Start/End: Original strand, 39525753 - 39525803
Alignment:
| Q |
97 |
gagaatggttgcttacgggagttttggaggatttgatgtttgtgatgatttg |
148 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39525753 |
gagaatggttgtttacgggagttttggagga-ttgatgtttgtgatgatttg |
39525803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University