View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13698_high_32 (Length: 210)
Name: NF13698_high_32
Description: NF13698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13698_high_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 8 - 191
Target Start/End: Original strand, 311455 - 311638
Alignment:
| Q |
8 |
agagagaagaacgttgttgctttcattgttgatgagggtggtggttttgtggttgattgaaatagaacaagttgttcggcgtttgtgatgagggatgatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |||||| ||||| |
|
|
| T |
311455 |
agagagaagaacgttgttgctttcattgttgatgagggtgttggttttgtggttgattgaaatagaacatgttgttcggcgtttgtgttgagggttgatt |
311554 |
T |
 |
| Q |
108 |
agattattaggttggaaagagagaagacgagacgaaggtgagaaatgggaagttacagtcataccccccatacccaaacctaaa |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
311555 |
agattattaggttggaaagagagaagacgagatgaaggtgagaaatgggaagttacagtcataccccccatacccaaacctaaa |
311638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University