View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13698_high_33 (Length: 208)
Name: NF13698_high_33
Description: NF13698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13698_high_33 |
 |  |
|
| [»] scaffold0079 (1 HSPs) |
 |  |  |
|
| [»] scaffold0384 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 1 - 183
Target Start/End: Complemental strand, 41075300 - 41075117
Alignment:
| Q |
1 |
taagtactcatatcaacccaaggacgaaccatcccaccatatcggatcactaagaggatcatcggaatcatctgagctctctactgctggctcagcaact |
100 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41075300 |
taagtactcatatcaacccaacgaagaaccatcccaccatatcggatcactaagacgatcatcggaatcatctgagctctctacttctggctcagcaact |
41075201 |
T |
 |
| Q |
101 |
tcttctatttcatcttttgaatggggcttcgtcgctacctctgtttatttaatgtttt-ttcaaataagaaacccaaaggtgag |
183 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41075200 |
tcttctattttgtcttttgaatggggcttcgtcgctacctctttttatttaatgttttgatcaaataagaaacccaaaggtgag |
41075117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0079 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: scaffold0079
Description:
Target: scaffold0079; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 78 - 183
Target Start/End: Original strand, 6451 - 6557
Alignment:
| Q |
78 |
tctctactgctggctcagcaacttcttctatttcatcttttgaatggggcttcgtcgctacctctgtttatttaatgtttt-ttcaaataagaaacccaa |
176 |
Q |
| |
|
|||||||| ||| || |||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
6451 |
tctctacttctgacttagcaacttcttctatttcgtcttttgaatggggcttcgtagctacctctgtttatttattgttttgatcaaataagaaacccaa |
6550 |
T |
 |
| Q |
177 |
aggtgag |
183 |
Q |
| |
|
|||||| |
|
|
| T |
6551 |
gggtgag |
6557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0384 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: scaffold0384
Description:
Target: scaffold0384; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 78 - 183
Target Start/End: Original strand, 3889 - 3995
Alignment:
| Q |
78 |
tctctactgctggctcagcaacttcttctatttcatcttttgaatggggcttcgtcgctacctctgtttatttaatgtttt-ttcaaataagaaacccaa |
176 |
Q |
| |
|
|||||||| ||| || |||||||||||||||||| ||||||||| |||||||||| |||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
3889 |
tctctacttctgacttagcaacttcttctatttcgtcttttgaacggggcttcgtagctacctctgtttatttattgttttgatcaaataagaaacccaa |
3988 |
T |
 |
| Q |
177 |
aggtgag |
183 |
Q |
| |
|
|||||| |
|
|
| T |
3989 |
gggtgag |
3995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University