View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13699_low_2 (Length: 369)
Name: NF13699_low_2
Description: NF13699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13699_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 20 - 351
Target Start/End: Original strand, 27844365 - 27844696
Alignment:
| Q |
20 |
aacagtctttgtcctacctccaaccgtcatcatctccgctcgaaccggtttcgctaaaacagaccggattgcttgtgttaggtcatggttcagacccgga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27844365 |
aacagtctttgtcctacctccaaccgtcatcatctcagctcgaaccggtttcgctaaaacagaccggattgcttgtgttagatcatggttcagacccgga |
27844464 |
T |
 |
| Q |
120 |
cgctcctcacaacacactgtcactttcatcctccgtggttctccttcctctttgccgcaataactcactgtcgcctcatctgattctcctggaaacggcc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27844465 |
cgctcctcacaacacactgtcactttcatcctccgtggttctccttcctctttgccgcaataactcactgtcgcctcatctgattctcctggaaacggcc |
27844564 |
T |
 |
| Q |
220 |
atatctcaactacctctgtagaattaactgaaccaggttctccgctgcacgaagaagaagactctccatcattgtgacgattcgccatttcatcagcttc |
319 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27844565 |
atgtctcaactacctctgtagaattaactgaaccaggttctccgctgcacgaagaagaagactctccatcattgtgacgattcgccatttcatcagcttc |
27844664 |
T |
 |
| Q |
320 |
cttcttcaaccgtttcacgtgctgcaccactt |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
27844665 |
cttcttcaaccgtttcacgtgctgcaccactt |
27844696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University