View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13699_low_5 (Length: 283)
Name: NF13699_low_5
Description: NF13699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13699_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 14 - 268
Target Start/End: Complemental strand, 33263230 - 33262978
Alignment:
| Q |
14 |
atgaatggtggttttaacttgtggaagtggagcttgacaggagttggagctatatgttcttttggtgttgctgctgccacaatttgtgtcttgttctttg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33263230 |
atgaatggtggttttaacttgtggaagtggagcttgacaggagttggagctatatgttcttttggtgttgctgctgccacaatttgtgtcttgttctttg |
33263131 |
T |
 |
| Q |
114 |
gaagtcaacaaaggaacaacaaactccaacaagaccaaagtattaggttcaagatctacactgatgacaaggtcagtaaatgnnnnnnngtttacatatg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33263130 |
gaagtcaacaaaggaacaacaaactccaacaagaccaaagtattaggttcaagatctacactgatgacaaggtcagtaaatgtttttttgtttacatatg |
33263031 |
T |
 |
| Q |
214 |
tgaattttctattcatagataactaatctctacgtaga--ctgaacaactaagatct |
268 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
33263030 |
tgaattttctattc----ataactaatctctacttagaatctgaacaactaagatct |
33262978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 72 - 129
Target Start/End: Original strand, 10062383 - 10062440
Alignment:
| Q |
72 |
cttttggtgttgctgctgccacaatttgtgtcttgttctttggaagtcaacaaaggaa |
129 |
Q |
| |
|
|||||||||||| |||||| | |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
10062383 |
cttttggtgttgttgctgcttctatttgtgttttgttctttggaagccaacaaaggaa |
10062440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University