View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1369_high_30 (Length: 408)
Name: NF1369_high_30
Description: NF1369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1369_high_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 2e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 30 - 144
Target Start/End: Complemental strand, 450945 - 450831
Alignment:
| Q |
30 |
atatgcacatacatttttatcaaataagttcccccctcaaaacaaaatgcatcggatgcacaatgtaaatcaaagctgggagcacacttactcatagagc |
129 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
450945 |
atatgaacatacatttttatcaaataagttcccccctcaaaacaaaatgcatcggatgcacaatgtaaatcaaagatgggagcacacttactcatagagc |
450846 |
T |
 |
| Q |
130 |
ttctgaaaatttaga |
144 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
450845 |
ttctgaaaatttaga |
450831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University