View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1369_high_40 (Length: 357)
Name: NF1369_high_40
Description: NF1369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1369_high_40 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 30 - 337
Target Start/End: Original strand, 19641291 - 19641598
Alignment:
| Q |
30 |
tcctttgcagtgggatgatgtaactccgaaaccaacattatctgttagcttgggtcagaactcaggtgtacacatgatatcccgcagtgagcagattccc |
129 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
19641291 |
tcctttgcagtcagatgatgtaactccgaaaccaacattatctgttagcttgggtcagaactcaggtctacacatgatatcctgcagtgagcagattccc |
19641390 |
T |
 |
| Q |
130 |
cgccgttcaaagcgtcttgctggaattaaggcagatcaacttaaaacaactcgagcgaatcaagatgtggttaaacaatcgggcgaggacaaaaccatcg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
19641391 |
cgccgttcaaagcgtcttgctggaattaaggcagatcaacttaaaacaactcgagcgaatcaagatgtggttaaacaatcgggcgagggcaaaaccatcg |
19641490 |
T |
 |
| Q |
230 |
taaatgcagatagatccactaataagttgccaaatgatcaattgaaaccgtttaatgcacttcatggttcagaagctaacttcaataacaaaagtactga |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19641491 |
taaatgcagatagatccactaataagttgccaaatgatcaagtgaaaccgtttaatgcacttcatggttcagaagctaacttcaataacaaaagtactga |
19641590 |
T |
 |
| Q |
330 |
aaacacaa |
337 |
Q |
| |
|
||||||| |
|
|
| T |
19641591 |
caacacaa |
19641598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University