View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1369_high_45 (Length: 344)
Name: NF1369_high_45
Description: NF1369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1369_high_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 333
Target Start/End: Original strand, 32353918 - 32354269
Alignment:
| Q |
1 |
atttcttattttgattataccatcttttatgatgtcattattgttcatagaatggtaaatcacctgggtatgaacatgtataattattagcctagggttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32353918 |
atttcttattttgattataccatcttttatgatgtcattattgttcaccgaatggtaaatcaccggggtatgaacatgtataattattagcctagggttc |
32354017 |
T |
 |
| Q |
101 |
ataccaaagtgttgtgaa-nnnnnnnngttttagaagtcgcaggaattattatattttcaatcttacttcttaaaaatatttgtaataaccttgaaacaa |
199 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32354018 |
ataccaaagtgttgtgaatttttttttgttttagaagtcgcaggaattattatattttcaatcttacttcttaaaaatatttgtaataaccttgaaacaa |
32354117 |
T |
 |
| Q |
200 |
ata--------------acatataaccacc----ttcaacatccattattctgatcaacatcagttttcactctaaccaccatcgattaccattctgacc |
281 |
Q |
| |
|
||| | ||||||| ||| ||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
32354118 |
atacaactttaacgcttatatataactaccgatgatcaacatccattattctgatcaacatcagttatcactctaaccaccaccgattaccattctgacc |
32354217 |
T |
 |
| Q |
282 |
atcgtcaaccactattccgaccactatgtcatccaccattatgaccatctct |
333 |
Q |
| |
|
| |||||||||| |||||||||||| ||||| ||||||||||||||| |||| |
|
|
| T |
32354218 |
accgtcaaccaccattccgaccactgtgtcaaccaccattatgaccacctct |
32354269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University