View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1369_high_52 (Length: 319)
Name: NF1369_high_52
Description: NF1369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1369_high_52 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 297
Target Start/End: Complemental strand, 55674479 - 55674183
Alignment:
| Q |
1 |
atttcatatcgtgtgatgatgggccgcatgtatagtctatgctacgggggaattaagtgggaagaaaactgaattcgagatgtgaattctgagggaactg |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55674479 |
atttcatatcttgtgatgatgggccgcatgtatagtctctggtacgggggaattaagtgggaagaaaactgaattcgagatgtgaattctgagggaactg |
55674380 |
T |
|
| Q |
101 |
aaactataagtgaattctgattgcaggatcaagctagaaaagcattagaaggtgcattaagtgggaagaaaattgagtttgagaagtgggacaaagaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55674379 |
aaactataagtgaattctgattgcaggatcaagctagaaaagcattagaaggtgcattaagtgggaagaaaattgagtttgagaagtgggacaaagaaat |
55674280 |
T |
|
| Q |
201 |
caaaagacgagaagagctgggaggtgtaggtgacggcggtggtggtggaggaggctggtttgggtggggtagatggtttggctggtctaatgatgat |
297 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55674279 |
caaaagacgagaagagctgggaggtggaggtgacggcggtggtggtggaggaggctggtttgggtggggtagatggtttggctggtctaatgatgat |
55674183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University