View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1369_high_54 (Length: 308)
Name: NF1369_high_54
Description: NF1369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1369_high_54 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 9 - 280
Target Start/End: Original strand, 28499184 - 28499455
Alignment:
| Q |
9 |
caacaaaatcgtggtgtcactgttattttgtcaaattgaatttgaatataagtatatacactaattctatatgcaaaattaattctattggagaatatct |
108 |
Q |
| |
|
||||||||||||||||||||| ||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28499184 |
caacaaaatcgtggtgtcactcttattttattaaattgaatttgaatataagtatatacactaattctatatgcaaaattaattctattggagaatatct |
28499283 |
T |
 |
| Q |
109 |
agctctatcaaaataaattctacttgtctgaaatcaatttgggctcgttacctaatgatt-atattcatgactacaattgcagggtctcatggaggcaga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
28499284 |
agctctatcaaaataaattctacttgtctgaaatcaatttggactcgttacctaatgattaatattcatgac-acagttgcagggtctcatggaggcaga |
28499382 |
T |
 |
| Q |
208 |
gaattcatattcatacgtgtataaaagaacatttgttatgaattgccattctcttaaatagaaattattatct |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28499383 |
aaattcatattcatacgtgtataaaagaacatttgtgatgaattgccattctcttaaatagaaattattatct |
28499455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University