View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1369_high_71 (Length: 230)
Name: NF1369_high_71
Description: NF1369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1369_high_71 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 29280341 - 29280230
Alignment:
| Q |
1 |
ctgatgaaatggtgacttcatcataactataatctcttgttctttcattaacatctttcatgcatatgatattgatactatgctactaactatagttctt |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29280341 |
ctgatgaaatggtgacttcatcatagctataatctcttgttctttcattaacatctttcatgcatatgatattgatactatgctactaactatagttctt |
29280242 |
T |
 |
| Q |
101 |
gcaccaacacat |
112 |
Q |
| |
|
| || ||||||| |
|
|
| T |
29280241 |
ggactaacacat |
29280230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University