View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1369_high_75 (Length: 212)
Name: NF1369_high_75
Description: NF1369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1369_high_75 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 42837163 - 42837366
Alignment:
| Q |
1 |
attgatctgatcggaatcaatcattcatcatcaatggagatggagacagatgaaggtataaacagtcttaaagctcgcatagaaactcaacacaagtcgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42837163 |
attgatctgatcggaatcaatcattcatcatcaatggagatggagacagatgaaggtataaacagtcttaaagctcgcatagaaactcaacacaagtcgc |
42837262 |
T |
|
| Q |
101 |
acatggacatgctttcttctgtacaatctgttatacctaattttgtttcttctctcgacctttctctcaaagttctctcttctttcaaccaccgtccctt |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
42837263 |
acatgtacatgctttcttctgtacaatctgttatacctaattttgtttcttctctcgacctttctctcaaagttctctcttctttcaaccaccgtccttt |
42837362 |
T |
|
| Q |
201 |
tgct |
204 |
Q |
| |
|
|||| |
|
|
| T |
42837363 |
tgct |
42837366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 71 - 204
Target Start/End: Complemental strand, 43915079 - 43914946
Alignment:
| Q |
71 |
aagctcgcatagaaactcaacacaagtcgcacatggacatgctttcttctgtacaatctgttatacctaattttgtttcttctctcgacctttctctcaa |
170 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| ||||||||||| || |
|
|
| T |
43915079 |
aagctcgcatagaaacccaacacaagtcacacatggacatgctttcttctgtacaatccgttatacctaatcttgtttcttctcttgacctttctctgaa |
43914980 |
T |
|
| Q |
171 |
agttctctcttctttcaaccaccgtccctttgct |
204 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
43914979 |
agttctctcttctttcaaccaccgtccttttgct |
43914946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 15 - 66
Target Start/End: Complemental strand, 43915156 - 43915105
Alignment:
| Q |
15 |
aatcaatcattcatcatcaatggagatggagacagatgaaggtataaacagt |
66 |
Q |
| |
|
|||| ||||||||||||| ||| | |||||||||||||||||| |||||||| |
|
|
| T |
43915156 |
aatccatcattcatcatccatgaacatggagacagatgaaggtttaaacagt |
43915105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University