View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1369_low_32 (Length: 403)
Name: NF1369_low_32
Description: NF1369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1369_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 9e-86; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 9e-86
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 32353942 - 32353782
Alignment:
| Q |
1 |
agatggtataatcaaaataagaaatgacatcataagattcaatcaagtagccattggggaaagaatcttcagaacttagctcagacaactttgaatatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32353942 |
agatggtataatcaaaataagaaatgacatcataagattcaatcaagtagccattggggaaagaatcttcagaacttagctcagacaactttgaatatgt |
32353843 |
T |
|
| Q |
101 |
acaacaaatttcttctttcaaaggtgcttacttggtggaataattctggtcacaaaatgtc |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32353842 |
acaacaaatttcttctttcaaaggtgcttacttggtggaataattctggtcacaaaatgtc |
32353782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 191 - 314
Target Start/End: Complemental strand, 32353751 - 32353628
Alignment:
| Q |
191 |
ccttatggtctttgctgtatttaccagtactatgatcatttcccttcattcctaatggccatcacgtgccattgcagtttcttcaattccctcatttttg |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32353751 |
ccttatggtctttgctgtatttaccagtactatgatcatttcccttcattcctaatggccatcacgtgccattgcagtttcttcaattccctcatttttg |
32353652 |
T |
|
| Q |
291 |
tttcttcttataaattcttatctt |
314 |
Q |
| |
|
|||||||||||| ||||||||||| |
|
|
| T |
32353651 |
tttcttcttatatattcttatctt |
32353628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University