View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1369_low_42 (Length: 362)
Name: NF1369_low_42
Description: NF1369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1369_low_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 67 - 339
Target Start/End: Original strand, 41764544 - 41764811
Alignment:
| Q |
67 |
atgatggtccattatgtctatgtacgagactctcgtgcttatgacctcttaaggataaccgtcaaagactacatcaatgtcctttccgaaaaatatccct |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41764544 |
atgatggtccattatgtctatgtacgagactctcgtgcttatgacctcttaaggataaccgtcaaagactacatcaatgtcctttccgaaaaatatccct |
41764643 |
T |
 |
| Q |
167 |
attggaaccgaagtcatggagctgatcatttcatacttgcttgccatgattgggtaaatctatcactagccnnnnnnncttaaaaatcttagtacatgca |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41764644 |
attggaaccgaagtcatggagctgatcatttcatacttgcttgccatgattgggtaaatctatcactagcatttttttcttaaaaatcttagtacatgca |
41764743 |
T |
 |
| Q |
267 |
ttctagtctagagtaagtgaacacttcttagcattttcctaaaagatatcatacatacatttattgtagtcaa |
339 |
Q |
| |
|
| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
41764744 |
t-----tctagagtaagtgaacacttcttagcattttcttaaaagatatcatacatacatttattgtagtcaa |
41764811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 116 - 222
Target Start/End: Original strand, 41756651 - 41756757
Alignment:
| Q |
116 |
taaggataaccgtcaaagactacatcaatgtcctttccgaaaaatatccctattggaaccgaagtcatggagctgatcatttcatacttgcttgccatga |
215 |
Q |
| |
|
|||||| |||| ||| ||| || |||||||| |||||||||||||||||| |||||||||||| | |||||||||||||||||| ||| |||||||||| |
|
|
| T |
41756651 |
taaggaaaaccatcacagattatatcaatgtggtttccgaaaaatatcccttttggaaccgaagccttggagctgatcatttcatgctttcttgccatga |
41756750 |
T |
 |
| Q |
216 |
ttgggta |
222 |
Q |
| |
|
||||||| |
|
|
| T |
41756751 |
ttgggta |
41756757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 139 - 221
Target Start/End: Complemental strand, 26973889 - 26973807
Alignment:
| Q |
139 |
atcaatgtcctttccgaaaaatatccctattggaaccgaagtcatggagctgatcatttcatacttgcttgccatgattgggt |
221 |
Q |
| |
|
||||||||| || | | ||||||||| |||||||| |||| | |||||||||||||||||| || ||||||||||| ||||| |
|
|
| T |
26973889 |
atcaatgtcattgctggaaaatatccatattggaatagaagccttggagctgatcatttcatgctagcttgccatgactgggt |
26973807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000005; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 157 - 222
Target Start/End: Original strand, 36806094 - 36806159
Alignment:
| Q |
157 |
aaatatccctattggaaccgaagtcatggagctgatcatttcatacttgcttgccatgattgggta |
222 |
Q |
| |
|
|||||| | |||||||| ||||| ||||||||||||||||||| ||| |||| |||||||||||| |
|
|
| T |
36806094 |
aaatatgcatattggaatagaagttatggagctgatcatttcatgctttcttgtcatgattgggta |
36806159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 223
Target Start/End: Original strand, 49301577 - 49301631
Alignment:
| Q |
169 |
tggaaccgaagtcatggagctgatcatttcatacttgcttgccatgattgggtaa |
223 |
Q |
| |
|
|||||| ||| |||||| ||||| || ||||| |||||||||||||||||||||| |
|
|
| T |
49301577 |
tggaacagaactcatggtgctgaccacttcatgcttgcttgccatgattgggtaa |
49301631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 157 - 222
Target Start/End: Complemental strand, 36515132 - 36515067
Alignment:
| Q |
157 |
aaatatccctattggaaccgaagtcatggagctgatcatttcatacttgcttgccatgattgggta |
222 |
Q |
| |
|
|||||| | |||||||| ||||| |||||||||| |||||||| ||| |||| |||||||||||| |
|
|
| T |
36515132 |
aaatatgcttattggaatagaagttatggagctgaccatttcatgctttcttgtcatgattgggta |
36515067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University