View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1369_low_58 (Length: 309)
Name: NF1369_low_58
Description: NF1369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1369_low_58 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 23 - 281
Target Start/End: Original strand, 49101283 - 49101539
Alignment:
| Q |
23 |
cacagatgacaatgtctcccaaattgattcagtgaattttgatatcactatcgttttcatgcttctcttaggtcggtttcaaagattgtggtaacgataa |
122 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
49101283 |
cacagatgacattgtctcccaaattgattcagtgaattttgatatcactatcgttttcatgcttctcttagatcg-tttcaaagattgtggtaacgataa |
49101381 |
T |
 |
| Q |
123 |
tgaattcctctgaagcaacatatcaaaagttacttgaggtagctttcttatgtaataacactttttaagagaggggaaagttaatttttggttatatcac |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49101382 |
tgaattcctctgaagcaacatatcaaaagttacttgaggtagctttcttatgtaataacactttttaagagaggggaaagttaatttttggttatatcac |
49101481 |
T |
 |
| Q |
223 |
ttcttgatgtaaacactaattcttttatctatgaaacaattatagtaaatttagaactt |
281 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
49101482 |
ttcttgatgtaaacactaattc-cttatctatgaaacaattatagtaaatttagaactt |
49101539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University