View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1369_low_68 (Length: 276)
Name: NF1369_low_68
Description: NF1369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1369_low_68 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 103 - 276
Target Start/End: Complemental strand, 43090992 - 43090814
Alignment:
| Q |
103 |
atacacacacattgaagaaatttagcagaagaagaagttgatatatttgttataactataagggaagggaagattaactaggaatgcattcaagagtgtg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43090992 |
atacacacacattgaagaaatttagcagaagaagaagttgatatatttgttataactataagggatgggaagattaactaggaatgcattcaagagtgtg |
43090893 |
T |
 |
| Q |
203 |
tcagatattttaggacac-----tgaagtatctatcttttttaaggacaagtcgctcatagggagggacagatgaatga |
276 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43090892 |
tcagatattttaggacactgaactgaagtatctatcttttttaaggacaagtcgctcatagggagggacagatgaatga |
43090814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 17 - 102
Target Start/End: Complemental strand, 43091137 - 43091052
Alignment:
| Q |
17 |
ccatattcagaagaaagaaagatgaattattcgatttctttttacgagtcacacaatcacaaactgtttctttgatttagggagtt |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43091137 |
ccatattcagaagaaagaaagatgaattattcgatttctttttacgagtcacacaatcacaaactttttctttgatttagggagtt |
43091052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University