View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1369_low_69 (Length: 269)
Name: NF1369_low_69
Description: NF1369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1369_low_69 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 22 - 140
Target Start/End: Complemental strand, 50427885 - 50427767
Alignment:
| Q |
22 |
agaagagcatgttggtttgatttggttcgagtttttggaaggtgtaggccacatagaggatgatcaatgtgaagatgaagaaaaatgagctggaagtgag |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50427885 |
agaagagcatgttggtttgatttggttcgagtttttggaaggtgtaggccacatagaggatgatcaatgtgaagatgaagaaaaatgagctggaagtgag |
50427786 |
T |
 |
| Q |
122 |
gtttagtggattgaccatg |
140 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
50427785 |
gtttagtggattgaccatg |
50427767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 32 - 121
Target Start/End: Complemental strand, 50422702 - 50422613
Alignment:
| Q |
32 |
gttggtttgatttggttcgagtttttggaaggtgtaggccacatagaggatgatcaatgtgaagatgaagaaaaatgagctggaagtgag |
121 |
Q |
| |
|
||||||||| |||||||||||||| ||||||| ||||| ||||||| |||| ||||||||||||||||||| || || |||||||||| |
|
|
| T |
50422702 |
gttggtttggtttggttcgagtttagggaaggtataggctacatagatgatggtcaatgtgaagatgaagaagaagaagttggaagtgag |
50422613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University