View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1369_low_79 (Length: 231)
Name: NF1369_low_79
Description: NF1369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1369_low_79 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 5 - 203
Target Start/End: Complemental strand, 43090992 - 43090789
Alignment:
| Q |
5 |
atacacacacattgaagaaatttagcagaagaagaagttgatatatttgttataactataagggaagggaagattaactaggaatgcattcaagagtgtg |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43090992 |
atacacacacattgaagaaatttagcagaagaagaagttgatatatttgttataactataagggatgggaagattaactaggaatgcattcaagagtgtg |
43090893 |
T |
 |
| Q |
105 |
tcagatattttaggacac-----tgaagtatctatcttttttaaggacaagtcgctcatagggagggacagatgaatgaatgaacattgaacatacatat |
199 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43090892 |
tcagatattttaggacactgaactgaagtatctatcttttttaaggacaagtcgctcatagggagggacagatgaatgaatgaacattgaacatacatat |
43090793 |
T |
 |
| Q |
200 |
aatt |
203 |
Q |
| |
|
|||| |
|
|
| T |
43090792 |
aatt |
43090789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University