View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1369_low_80 (Length: 231)
Name: NF1369_low_80
Description: NF1369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1369_low_80 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 22 - 216
Target Start/End: Original strand, 43091052 - 43091246
Alignment:
| Q |
22 |
aactccctaaatcaaagaaacagtttgtgattgtgtgactcgtaaaaagaaatcgaataattcatctttctttcttctgaatatggttctgttactttta |
121 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43091052 |
aactccctaaatcaaagaaaaagtttgtgattgtgtgactcgtaaaaagaaatcgaataattcatctttctttcttctgaatatggttctgttactttta |
43091151 |
T |
 |
| Q |
122 |
tgcattaaagctgaaccaataaaagatagctttttagatgaatcaacattgttcctttttccatctccaacaccctactactacctaatacatac |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43091152 |
tgcattaaagctgaaccaataaaagatagctttttagatgaatcaacattgttcctttttccatctccaacaccctactactacctaatacatac |
43091246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University