View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1369_low_81 (Length: 230)

Name: NF1369_low_81
Description: NF1369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1369_low_81
NF1369_low_81
[»] chr3 (1 HSPs)
chr3 (1-112)||(29280230-29280341)


Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 29280341 - 29280230
Alignment:
1 ctgatgaaatggtgacttcatcataactataatctcttgttctttcattaacatctttcatgcatatgatattgatactatgctactaactatagttctt 100  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29280341 ctgatgaaatggtgacttcatcatagctataatctcttgttctttcattaacatctttcatgcatatgatattgatactatgctactaactatagttctt 29280242  T
101 gcaccaacacat 112  Q
    | || |||||||    
29280241 ggactaacacat 29280230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University