View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1369_low_89 (Length: 209)

Name: NF1369_low_89
Description: NF1369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1369_low_89
NF1369_low_89
[»] chr4 (1 HSPs)
chr4 (1-133)||(54020155-54020287)


Alignment Details
Target: chr4 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 54020155 - 54020287
Alignment:
1 aaaagttcgggtgggttagagaaatgcagcagtcaatgataaaaacaatatgatctataccatcagccaggttggaagattaaaccattttccatgagac 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||     
54020155 aaaagttcgggtgggttagagaaatgcagcagtcaatgataaaaacaatatgatctatactatcagccaggttggaagattaaaccattttccatgagat 54020254  T
101 gatgattgatcttaataaaattagtagtattat 133  Q
    ||||||| ||||||||||||||| |||||||||    
54020255 gatgatttatcttaataaaattattagtattat 54020287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University