View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1369_low_91 (Length: 205)
Name: NF1369_low_91
Description: NF1369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1369_low_91 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 130
Target Start/End: Complemental strand, 7554220 - 7554091
Alignment:
| Q |
1 |
caaactctaaaatgtcaaatgtttcnnnnnnnacagatttacttctgttagaatttacttttttaatgtcagttatgataagaatgttataactttgtat |
100 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7554220 |
caaactctaaaatgtcaaatttttctttttttacagatttacttctgttagaatttacttttttaatgtcagttatgataagaatgttataactttgtat |
7554121 |
T |
|
| Q |
101 |
tctctgtagtgtttcttttatattgttgga |
130 |
Q |
| |
|
||||||||||||||||||||| |||||||| |
|
|
| T |
7554120 |
tctctgtagtgtttcttttatgttgttgga |
7554091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University