View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1370-INSERTION-2 (Length: 143)
Name: NF1370-INSERTION-2
Description: NF1370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1370-INSERTION-2 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 8e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 8e-53
Query Start/End: Original strand, 7 - 143
Target Start/End: Original strand, 12225754 - 12225890
Alignment:
| Q |
7 |
aaaagtccctcttcatctctaatacaaacacagattccaactttgttgagagagttggaaaaagatgcatccacattgaatttatactgtcccaggcctg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |||| |||| || |
|
|
| T |
12225754 |
aaaagtccctcttcatctctaatacaaacacagattccgactttgttgagagagttggaaaaagatgcatccacattgcatttataacgtcctaggcttg |
12225853 |
T |
|
| Q |
107 |
gtttcttccattgcacacatgcagtggttgctgaagt |
143 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
12225854 |
gtttcttccattgcacacacgcagtgattgctgaagt |
12225890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 85; Significance: 7e-41; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 85; E-Value: 7e-41
Query Start/End: Original strand, 7 - 135
Target Start/End: Complemental strand, 10210842 - 10210714
Alignment:
| Q |
7 |
aaaagtccctcttcatctctaatacaaacacagattccaactttgttgagagagttggaaaaagatgcatccacattgaatttatactgtcccaggcctg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||| ||||||||||||||||||||||||||||||||| ||||||| | || |||| || |
|
|
| T |
10210842 |
aaaagtccctcttcatctctaatacaaacaccgattccgactttattgagagagttggaaaaagatgcatccacattgcatttataacggcctaggcttg |
10210743 |
T |
|
| Q |
107 |
gtttcttccattgcacacatgcagtggtt |
135 |
Q |
| |
|
||| | ||||||||||||||||||||||| |
|
|
| T |
10210742 |
gttacgtccattgcacacatgcagtggtt |
10210714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 2e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 13 - 125
Target Start/End: Original strand, 42927087 - 42927199
Alignment:
| Q |
13 |
ccctcttcatctctaatacaaacacagattccaactttgttgagagagttggaaaaagatgcatccacattgaatttatactgtcccaggcctggtttct |
112 |
Q |
| |
|
|||||||||||||| || ||||||| || ||||| ||||| |||||||| ||||||||||||||||||||| |||||||| | || ||| ||||| | |
|
|
| T |
42927087 |
ccctcttcatctcttatgcaaacaccaatgccaaccttgttaagagagttagaaaaagatgcatccacattgcatttataccgccctgggctcggtttat |
42927186 |
T |
|
| Q |
113 |
tccattgcacaca |
125 |
Q |
| |
|
||||||||||||| |
|
|
| T |
42927187 |
tccattgcacaca |
42927199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University