View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1370-INSERTION-4 (Length: 161)
Name: NF1370-INSERTION-4
Description: NF1370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1370-INSERTION-4 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 46 - 161
Target Start/End: Complemental strand, 52765410 - 52765295
Alignment:
| Q |
46 |
ctaatgatacacaattcatagattgcttgttttagtgcatatggaagaatcagaaactctaccgaaaatttccctacatttgtaattactggcgcattgc |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52765410 |
ctaatgatacacaattcatagattgcttgttttagtgcatatggaagaatcagaaactctaccgaaaatttccctacatttgtaattactggcgcattgc |
52765311 |
T |
 |
| Q |
146 |
atgtgctacgtaacct |
161 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
52765310 |
atgtgctacgtaacct |
52765295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University