View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13700_high_4 (Length: 274)
Name: NF13700_high_4
Description: NF13700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13700_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 170 - 264
Target Start/End: Original strand, 31423694 - 31423788
Alignment:
| Q |
170 |
agagagggtgccgtcagcgggaacaacagagatggtggtgcaaggtggttgttggtgtggctggtgatgatgtgatgtctcgttggtgatgatgt |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31423694 |
agagagggtgccgtcagcgggaacaacagagatggtggtgcaaggtggttgttggtatggctggtgatgatgtgatgtctcgttggtgatgatgt |
31423788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 50 - 104
Target Start/End: Original strand, 31423574 - 31423628
Alignment:
| Q |
50 |
cacggttgttttgttgttcacagattttgaggtggttgctgagtttgaatgttga |
104 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31423574 |
cacggttgtgttgttgttcacggattttgaggtggttgctgagtttgaatgttga |
31423628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University