View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13701_low_7 (Length: 390)
Name: NF13701_low_7
Description: NF13701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13701_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 15 - 374
Target Start/End: Original strand, 43271314 - 43271651
Alignment:
| Q |
15 |
atcatcatcgtaatggtacaccaattaccaannnnnnnncaactgccatgcatacgttgccatttatttgtcggtaggctaagatttccaaaagagaaat |
114 |
Q |
| |
|
||||| ||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43271314 |
atcattatcgtaatggtacgccaattaccaattttttttcaactgccatgcatacgttgccatttatttgtcggtaggctaagatttccaaaagagaagt |
43271413 |
T |
 |
| Q |
115 |
gattttcaaatatcaaaattttaatgtcaaacatcgcacgttttagttttagtgtgtannnnnnnnnnnnccatagattcgttccattaaagataatcat |
214 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
43271414 |
gattttca---------------------aacatcgcacattttagttttagtgtgtattttttctttttccatagattcattccattaaagataatcat |
43271492 |
T |
 |
| Q |
215 |
atttgagacaccattaatcactaaaagcagacattcataataaaaattggaactttgatctacacattgtgagtttagtctctttgcttaaccaaccctt |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43271493 |
atttgagacaccattaatcactaaaagcagacattcataataaaaattgaaactttgatctacacattgtgagtttagtctctttgcttaaccaaccctt |
43271592 |
T |
 |
| Q |
315 |
agttggtaattttatcatgtattttttcaaaccttgttggcagttttactaccacatttg |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43271593 |
-gttggtaattttatcatgtattttttcaaaccttgttggcagttttactaccacatttg |
43271651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University