View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13701_low_8 (Length: 365)
Name: NF13701_low_8
Description: NF13701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13701_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 6 - 340
Target Start/End: Original strand, 13048915 - 13049248
Alignment:
| Q |
6 |
agtgagaattgaaagatacccctaaaatgaaagctttatttagaattcaatcatacaaaacagttagaagtcactattagtttgccaaaagacaaaccct |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13048915 |
agtgagaattgaaagatacccctaaaatgaaagctttatttagaattcaatcatacaaaacagttagaagtcactattagtttgccaaaagacaaaccct |
13049014 |
T |
|
| Q |
106 |
cgttttaccactatatatgaaataatatgtatcaacaggtaagaactttctttctgatgcttttcagaggcacatgtggtgggttcatgtatacccccat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13049015 |
cgttttaccactatatatgaaataatatgtatcaacaggtaagaactttctttctgatgcttttcagaggcacatgtggtgggttcatgtatacccccat |
13049114 |
T |
|
| Q |
206 |
ttgaattcagctactgctttcaagttcaggtagctagatataagaatcactgtgaatgttaaatttattgcttttgcaaattatagcaacctaaggtttt |
305 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13049115 |
ttggattcagctactgctttcaagttcaggtagctagatataagaatcactgtgaatgtt-aatttattgcttttgcaaattatagcaacctaaggtttt |
13049213 |
T |
|
| Q |
306 |
gggagcaagccagctcacctgtttgtgcatgtatg |
340 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13049214 |
gggagtaagccagctcacctgtttgtgcatgtatg |
13049248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University