View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13702_low_14 (Length: 300)
Name: NF13702_low_14
Description: NF13702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13702_low_14 |
 |  |
|
| [»] scaffold1211 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 20 - 289
Target Start/End: Original strand, 26376662 - 26376931
Alignment:
| Q |
20 |
gtacttacagattcacttttattaacagcaaactatttattgtttcatttttattgttggtctttcattgttatgatggaaaacatgaaattcaccgcta |
119 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26376662 |
gtacttacagattcatttttattaacagcaaactatttattgtttcatttttattgctggtctttcattgttatgatggaaaacatgaaattcaccgcta |
26376761 |
T |
 |
| Q |
120 |
atggtgattttctgttgttagatcatcaattgattttgtttgctcatccacctacaggtagagcattggctattttcagatcaaaagatgcagctgcaaa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26376762 |
atggtgattttctgttgttagatcatcaattgattttgtttgctcatccacctacaggtagagcattggctattttcagatcaaaagatgcaggtgcaaa |
26376861 |
T |
 |
| Q |
220 |
cgcaatatctgagttgaacaggagatgccttattcttgaagacgggaggtatttcatttatcactttctt |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26376862 |
cgcaatatctgagttgaacaggagatgccttattcttgaagacgggaggtatttcatttatcgctttctt |
26376931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1211 (Bit Score: 133; Significance: 4e-69; HSPs: 1)
Name: scaffold1211
Description:
Target: scaffold1211; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 20 - 260
Target Start/End: Original strand, 629 - 869
Alignment:
| Q |
20 |
gtacttacagattcacttttattaacagcaaactatttattgtttcatttttattgttggtctttcattgttatgatggaaaacatgaaattcaccgcta |
119 |
Q |
| |
|
||||||||||||| | ||| || ||||||||| ||| | ||||||||||||||||||| |||||| |||| | |||||||||||| ||||||| ||| |
|
|
| T |
629 |
gtacttacagatttattttcatgaacagcaaattatatcatgtttcatttttattgttgatctttctttgtaacgatggaaaacatcaaattcaaaacta |
728 |
T |
 |
| Q |
120 |
atggtgattttctgttgttagatcatcaattgattttgtttgctcatccacctacaggtagagcattggctattttcagatcaaaagatgcagctgcaaa |
219 |
Q |
| |
|
||| | ||||||||||||||||||||||| |||||||||||||||||| ||| |||||||||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
729 |
atgataattttctgttgttagatcatcaactgattttgtttgctcatctaccgacaggtagagcattggttattttcagatcaaaagatgcagctgaaaa |
828 |
T |
 |
| Q |
220 |
cgcaatatctgagttgaacaggagatgccttattcttgaag |
260 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| ||||||||| |
|
|
| T |
829 |
tgcaatatctgagttgaccagcagatgccttgttcttgaag |
869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University