View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13702_low_17 (Length: 280)
Name: NF13702_low_17
Description: NF13702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13702_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 11 - 250
Target Start/End: Original strand, 1455793 - 1456032
Alignment:
| Q |
11 |
catcatcatgtgaccataacaagtcctccacttgcgtaacatatttgtttgctgcttgctttatggatcttaggaacctcatctctgcaaccacaaatnn |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1455793 |
catcatcatgtgaccataacaagtcctccacttgcgtaacatatttgtttgctgcttgctttatggatcttaggaacctcatctctccaaccacaaataa |
1455892 |
T |
 |
| Q |
111 |
nnnnntcaacaagggtttgtatattgcattgggaagacggtaacaatagggtttcgtttttgacaaaaacgatagggttttgttggtttggttgttcgac |
210 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1455893 |
aaaaatcaacaacggtttgtatattgcattgggaagacggtaacaatagggttttgtttttgacaaaaacgatagggttttgttggtttggttgttcgac |
1455992 |
T |
 |
| Q |
211 |
aaaaatggaataaattaagtgtttagcatcggagaaaact |
250 |
Q |
| |
|
||||||||||||||||||| |||||| || |||||||||| |
|
|
| T |
1455993 |
aaaaatggaataaattaagggtttagtattggagaaaact |
1456032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University