View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13702_low_5 (Length: 494)
Name: NF13702_low_5
Description: NF13702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13702_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 304; Significance: 1e-171; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 8 - 346
Target Start/End: Complemental strand, 2600854 - 2600515
Alignment:
| Q |
8 |
agattatactactaataattccaaagagcttcatgtgaaaaccaccgtacaaagaagccgctccaccggtgctggacgaggataccgtaccggaaaagtt |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2600854 |
agataatactactaataattccaaagagcttcgtgtgaaaaccaccgtacaaagaagccattccaccggtgctggaagaggataccgtaccggaaaagtt |
2600755 |
T |
|
| Q |
108 |
tcaccagcgatcgaaccaccgtctccaaaggtctctgcgtgtggattctgtagtccttttgggaaaaagggtcaacgatcaaagcccggtaaacgtcggt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2600754 |
tcaccagcgatcgaaccaccgtctccaaaggtctccgcgtgtggattctgtagtccttttgggaaaaagggtcaacgatcaaagcccggtaaacgtcggt |
2600655 |
T |
|
| Q |
208 |
cgaggtaggtatggtagcttgttgttgaattgaatcatagtgagtgttttccggtggccggaaaagggatattccggtgggtagggtgagtt-ttttgag |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
2600654 |
cgaggtaggtatggtagcttgttgttgaattgaatcatagtgagtgttttccggtggccggaaaagggatattccggtgagtagggtgagtttttttgag |
2600555 |
T |
|
| Q |
307 |
ttgagttcataagaagaagaataaataacagagttgtgaa |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2600554 |
ttgagttcataagaagaagaataaataacagagttgtgaa |
2600515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 417 - 477
Target Start/End: Complemental strand, 2600446 - 2600386
Alignment:
| Q |
417 |
tgtgtttggattaatagttggcttgtaattattatgtgcataataatagttgtgtttaaac |
477 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2600446 |
tgtgtttggattaattgttggcttgtaattattatgtgcataataatagttgtgtttaaac |
2600386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 57 - 173
Target Start/End: Original strand, 44510489 - 44510605
Alignment:
| Q |
57 |
caaagaagccgctccaccggtgctggacgaggataccgtaccggaaaagtttcaccagcgatcgaaccaccgtctccaaaggtctctgcgtgtggattct |
156 |
Q |
| |
|
|||||||| || |||| ||||| ||||| || |||||||||||||||||||| || ||||| || ||||||||||| | | | ||||| ||||| || | |
|
|
| T |
44510489 |
caaagaagtcgttccaacggtggaggacgtggttaccgtaccggaaaagtttctccggcgattgagccaccgtctcctaggatttctgcttgtgggtttt |
44510588 |
T |
|
| Q |
157 |
gtagtccttttgggaaa |
173 |
Q |
| |
|
|| || ||||||||||| |
|
|
| T |
44510589 |
gtggtgcttttgggaaa |
44510605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University