View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13703_high_14 (Length: 279)
Name: NF13703_high_14
Description: NF13703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13703_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 55338299 - 55338083
Alignment:
| Q |
1 |
catgttgaaagtggaaaacctggggggttgaatttgtaacttgaaagttacatacaagtagtcttaattatagctagaaagggtcaaccaaacacaagaa |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
55338299 |
catgttgaaaatggaaaacctggggggttgaatttgtaacttgaaagttacatataagtagtcttaattatagctggaaagggtcagccaaacacaagaa |
55338200 |
T |
 |
| Q |
101 |
ggccaattcttgttttatgaatttgtcaaaattttcttcacttccattttggttcggtatggttccatcatgaattgactctcacctaagtcttaattcc |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55338199 |
ggacaattcttgttttatgaatttgtcaaaattttcttcacttccattttggtttggtatggttccatcatgaattgactctcacctaagtcttaattcc |
55338100 |
T |
 |
| Q |
201 |
aatccacactattcaaa |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
55338099 |
aatccacactattcaaa |
55338083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University