View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13703_low_12 (Length: 301)
Name: NF13703_low_12
Description: NF13703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13703_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 2 - 287
Target Start/End: Complemental strand, 33780673 - 33780381
Alignment:
| Q |
2 |
ttttgcatatttaagccttttgttcacgatgtgaaatcaaaacc------tccattagtctattgtacaatttatataacttccgannnnnnnnnnnnca |
95 |
Q |
| |
|
|||| ||| ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| || |
|
|
| T |
33780673 |
ttttacatttttaagccttttgttcatgatgtgaaatcaaaaccacattctccattagtctattgtacaatttatataacttccgattttttgtttttca |
33780574 |
T |
 |
| Q |
96 |
tttggcttctctatatcgtgcagttttgaatgtgaaatgaataataccatatgaactaatgaacnnnnnnntggtcaattttatgtacaaacatatctaa |
195 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
33780573 |
tttggcttctctataacgtgcagttttgaatgtaaaatgaataataccatatgaactaacgaacaaacaaatggtcaattttatgtacaaacatatctaa |
33780474 |
T |
 |
| Q |
196 |
tcatgactgtaacaacatagtaattttttatttcctttac-tgtttttaggtcaagtagtttagtggctaaagaaattcactattaaagatga |
287 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||| | |||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
33780473 |
tcatgactgtaccaacatagcgattttttatttcctttacttttttttaggtcaagtagcttagtagctaaagaaattcactattaaagatga |
33780381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 275
Target Start/End: Complemental strand, 32376565 - 32376528
Alignment:
| Q |
238 |
tttttaggtcaagtagtttagtggctaaagaaattcac |
275 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
32376565 |
ttttttggtcaagtagtttagcggctaaagaaattcac |
32376528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 275
Target Start/End: Complemental strand, 7438747 - 7438710
Alignment:
| Q |
238 |
tttttaggtcaagtagtttagtggctaaagaaattcac |
275 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
7438747 |
ttttttggtcaagtagtctagtggctaaagaaattcac |
7438710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 287
Target Start/End: Original strand, 47428864 - 47428912
Alignment:
| Q |
238 |
tttttaggtcaagtagtttagtggctaaagaaattcactattaaagatga |
287 |
Q |
| |
|
||||| |||||| ||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
47428864 |
ttttttggtcaaatagcttagtggctaaagaaattcact-ttaaagatga |
47428912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University