View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13703_low_16 (Length: 283)
Name: NF13703_low_16
Description: NF13703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13703_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 15 - 267
Target Start/End: Original strand, 17107030 - 17107282
Alignment:
| Q |
15 |
tcttgcgcaacatttgtttaatgatcctagcatccaggaaaattttgatgttttagcttgggtacatgtttctggtgaatttaatgctcttcaaataatg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17107030 |
tcttgcgcaacatttgtttaatgatcctagcatccaggaaaattttgatgttttagcttgggtacatgtttctggtgaatttaatgctcttcaaataatg |
17107129 |
T |
 |
| Q |
115 |
agggacactcttgcagaaatcagtggttcataccttaatgatactaatttcactctggttcaacgtaaggtagcaaatgaactgaaagggaagaagtttt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
17107130 |
agggacactcttgcagaaatcagtggttcataccttaatgatactaatttcactctggttcaacgtaaggtagcaaatgaactgaatgggaagaagtttt |
17107229 |
T |
 |
| Q |
215 |
ttattgttttggacaatatgtggaatgacgacgaagtggaattggaagatttg |
267 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
17107230 |
ttattgttttggacaatatgtggaatgacaacgaagtggaattgaaagatttg |
17107282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University