View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13703_low_24 (Length: 222)

Name: NF13703_low_24
Description: NF13703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13703_low_24
NF13703_low_24
[»] chr5 (1 HSPs)
chr5 (1-154)||(12351701-12351854)


Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 154
Target Start/End: Original strand, 12351701 - 12351854
Alignment:
1 atcgaggatttggtcgttttgattgtgtttggaagggtttttagtgcaagtagcagttaataggtgtttgaaacactcttcaatggtcatttgtgatgga 100  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| ||||||||| ||||||||    
12351701 atcgaggatttggtcgttttgattgtgtttggaagggtttttggtgcaagtagcagttaataggtgtttgaaactctcttcgatggtcattcgtgatgga 12351800  T
101 gtttaagatttttgcttaactttggtttctaaagttgtgtaggagtttgacatt 154  Q
    |||||||||||||||||||||||||||||||| ||||||||||  |||||||||    
12351801 gtttaagatttttgcttaactttggtttctaatgttgtgtagggatttgacatt 12351854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University