View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13703_low_6 (Length: 353)
Name: NF13703_low_6
Description: NF13703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13703_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 3 - 223
Target Start/End: Original strand, 38883241 - 38883461
Alignment:
| Q |
3 |
gttaatttctgctcagttttgtgttttatgatgttctgattttgcttcattgtagggttgacatgttattcttattatccatgttggtgttctgcaacag |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38883241 |
gttaatttctgctcagttttgtgttttatgatgttctgattttgcttcattgtagggttgacatgttattcttattatccatgttggtgttctgcaacag |
38883340 |
T |
 |
| Q |
103 |
cattatgtcctttgtggcaacatcatcagtttgcacactctccatccccctaaaggttttcagttggaaatctatgctagcattgtggtcattgtctttc |
202 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38883341 |
cattacgtcctttgtggcaacatcatcagtttgcatactctccatccccctaaaggttttcagttggaaatctatgctagcattgtggtcattgtctttc |
38883440 |
T |
 |
| Q |
203 |
tacctgttaagttgcttcttg |
223 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
38883441 |
tacctgttaagttgcttcttg |
38883461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University