View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13704_high_5 (Length: 281)
Name: NF13704_high_5
Description: NF13704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13704_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 17 - 169
Target Start/End: Complemental strand, 30889977 - 30889825
Alignment:
| Q |
17 |
aagtatatgttccaatttcataccattataaaaatttaaacgagtgaatttaaatcatacaaaaaatttgtggcaccgattgctcacaccactttcaaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30889977 |
aagtatatgttccaatttcataccattataaaaatttaaacgagtgaatttaaatcatacaaaaaatttgtggcaccgattgctcacaccactttcaaaa |
30889878 |
T |
 |
| Q |
117 |
aatttataaattactaagtatcttgtagtttggtttggtaagtacttatatgc |
169 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30889877 |
aaattataaattactaagtatcttgtagtttggtttggtaagtacttatatgc |
30889825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University