View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13704_high_8 (Length: 228)

Name: NF13704_high_8
Description: NF13704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13704_high_8
NF13704_high_8
[»] chr3 (1 HSPs)
chr3 (34-88)||(20899153-20899207)


Alignment Details
Target: chr3 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 34 - 88
Target Start/End: Original strand, 20899153 - 20899207
Alignment:
34 ttatactgcagacggggaggtttgtacacttacttagatccgtttgacctgatag 88  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20899153 ttatactgcagacggggaggtttgtacacttacttagatccgtttgacctgatag 20899207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University