View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13704_low_7 (Length: 273)
Name: NF13704_low_7
Description: NF13704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13704_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 9 - 256
Target Start/End: Original strand, 25550317 - 25550560
Alignment:
| Q |
9 |
gaaaagaaatggaaattcctaatgcttctccacacccaacaagatgggacaatcaatcccacttattttagcaacttatcctaatgcctcttccccaaga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25550317 |
gaaaagaaatggaaattcctaatgcttctccacacccaacaagatgggacaatcaatcccacttattttagcaacttatcctaatggctcttccccaaga |
25550416 |
T |
 |
| Q |
109 |
gctctctgacgacagcagaggtacaacctgcctagtctgagggagggagcgacttttattgtccttttatccggacgactcaaggaaagcgataagagac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25550417 |
gctctctgacgacagcagaggtacaacctgcctattct----gagggagcgacttttattgtccttttatccggacgactcaaggaaagcgatacgagac |
25550512 |
T |
 |
| Q |
209 |
ttgtttgttcatcttttggtgtatgcaggacaccatcaacggcgtatg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25550513 |
ttgtttgttcatcttttggtgtatgcaggacaccatcaacggtgtatg |
25550560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University